Have questions? Visit https://www.reddit.com/r/SNPedia

rs312262714

From SNPedia

ClinVar
Risk rs312262714(;)
Alt rs312262714(;)
Reference rs312262714(GGCATTGCAAAAGCTCATTGA;GGCATTGCAAAAGCTCATTGA)
Significance Pathogenic
Disease Spastic paraplegia 11
Variation info
Gene SPG11
CLNDBN Spastic paraplegia 11, autosomal recessive
Reversed 1
HGVS NC_000015.9:g.44952644_44952664del21
CLNSRC ClinVar GeneReviews
CLNACC RCV000034215.2,


[PMID 19105190] Screening of ARHSP-TCC patients expands the spectrum of SPG11 mutations and includes a large scale gene deletion.