Have questions? Visit https://www.reddit.com/r/SNPedia

rs36212066

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(AGCCTGGATGGCTTCCCTCCCTCTC;AGCCTGGATGGCTTCCCTCCCTCTC) 0 common in complete genomics
(D;D) 4 Hypertrophic Cardiomyopathy
(I;D) 3 Hypertrophic Cardiomyopathy carrier
(I;I) 0
Make rs36212066(-;-)
Make rs36212066(-;AGCCTGGATGGCTTCCCTCCCTCTC)
ReferenceGRCh38 38.1/141
Chromosome11
Position47332275
GeneMYBPC3
is asnp
is mentioned by
dbSNPrs36212066
ebirs36212066
HLIrs36212066
Exacrs36212066
Varsomers36212066
Maprs36212066
PheGenIrs36212066
hapmaprs36212066
1000 genomesrs36212066
hgdprs36212066
ensemblrs36212066
gopubmedrs36212066
geneviewrs36212066
scholarrs36212066
googlers36212066
pharmgkbrs36212066
gwascentralrs36212066
openSNPrs36212066
23andMers36212066
23andMe allrs36212066
SNP Nexus

SNPshotrs36212066
SNPdbers36212066
MSV3drs36212066
GWAS Ctlgrs36212066
Max Magnitude4
https://www.23andme.com/you/journal/hypertrophic_cardiomyopathy/techreport/


ClinVar
Risk rs36212066(;)
Alt rs36212066(;)
Reference rs36212066(AGCCTGGATGGCTTCCCTCCCTCTC;AGCCTGGATGGCTTCCCTCCCTCTC)
Significance Probable-Pathogenic
Disease Familial hypertrophic cardiomyopathy 4 not specified Primary familial hypertrophic cardiomyopathy
Variation info
Gene MYBPC3
CLNDBN Familial hypertrophic cardiomyopathy 4 not specified Primary familial hypertrophic cardiomyopathy
Reversed 1
HGVS NC_000011.9:g.47353826_47353850del25
CLNSRC
CLNACC RCV000154274.3, RCV000158391.2, RCV000211730.1,