Have questions? Visit https://www.reddit.com/r/SNPedia

rs377767362

From SNPedia

ClinVar
Risk rs377767362(;)
Alt rs377767362(;)
Reference rs377767362(AGCAGCAGGCGGCTACTGCACAA;AGCAGCAGGCGGCTACTGCACAA)
Significance Pathogenic
Disease Juvenile polyposis syndrome
Variation info
Gene SMAD4
CLNDBN Juvenile polyposis syndrome
Reversed 0
HGVS NC_000018.9:g.48603042_48603064del23
CLNSRC ClinVar
CLNACC RCV000021733.1,


[PMID 15235019OA-icon.png] The prevalence of MADH4 and BMPR1A mutations in juvenile polyposis and absence of BMPR2, BMPR1B, and ACVR1 mutations.