Have questions? Visit https://www.reddit.com/r/SNPedia

rs377767365

From SNPedia

ClinVar
Risk rs377767365(;)
Alt rs377767365(;)
Reference rs377767365(GGCCCAGGATCAGTAGGTGGAATAG;GGCCCAGGATCAGTAGGTGGAATAG)
Significance Pathogenic
Disease Juvenile polyposis syndrome
Variation info
Gene SMAD4
CLNDBN Juvenile polyposis syndrome
Reversed 0
HGVS NC_000018.9:g.48603110_48603134del25
CLNSRC ClinVar
CLNACC RCV000021736.1,


[PMID 18178612] Large genomic deletions of SMAD4, BMPR1A and PTEN in juvenile polyposis.