Have questions? Visit https://www.reddit.com/r/SNPedia

rs3836790

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in complete genomics
Make rs3836790(-;TGTCTGAGTGTGTATGTTGCATGGTATGTG)
Make rs3836790(TGTCTGAGTGTGTATGTTGCATGGTATGTG;TGTCTGAGTGTGTATGTTGCATGGTATGTG)
ReferenceGRCh38 38.1/141
Chromosome5
Position1411740
GeneSLC6A3
is asnp
is mentioned by
dbSNPrs3836790
ebirs3836790
HLIrs3836790
Exacrs3836790
Varsomers3836790
Maprs3836790
PheGenIrs3836790
hapmaprs3836790
1000 genomesrs3836790
hgdprs3836790
ensemblrs3836790
gopubmedrs3836790
geneviewrs3836790
scholarrs3836790
googlers3836790
pharmgkbrs3836790
gwascentralrs3836790
openSNPrs3836790
23andMers3836790
23andMe allrs3836790
SNP Nexus

SNPshotrs3836790
SNPdbers3836790
MSV3drs3836790
GWAS Ctlgrs3836790
Max Magnitude0

[PMID 21525861OA-icon.png] Dopamine Transporter Gene Variant Affecting Expression in Human Brain is Associated with Bipolar Disorder

[PMID 23340505OA-icon.png] Dopamine transporter DAT and receptor DRD2 variants affect risk of lethal cocaine abuse: a gene-gene-environment interaction

[PMID 25805645] Polymorphism of the dopamine transporter type 1 gene modifies the treatment response in Parkinson's disease

[PMID 25850966] Genetic variation of the dopamine transporter (DAT1) influences the acute subjective responses to cocaine in volunteers with cocaine use disorders