Have questions? Visit https://www.reddit.com/r/SNPedia

rs386134216

From SNPedia

ClinVar
Risk rs386134216(;)
Alt rs386134216(;)
Reference rs386134216(AGGGACCATGTGCATCTATGG;AGGGACCATGTGCATCTATGG)
Significance Untested
Disease Renal carnitine transport defect
Variation info
Gene SLC22A5
CLNDBN Renal carnitine transport defect
Reversed 0
HGVS NC_000005.9:g.131726599_131726619del21
CLNSRC ClinVar
CLNACC RCV000022369.2,


[PMID 15714519] Validation of dye-binding/high-resolution thermal denaturation for the identification of mutations in the SLC22A5 gene.