Have questions? Visit https://www.reddit.com/r/SNPedia

rs386833472

From SNPedia

ClinVar
Risk rs386833472(ACCGGTTTTGAAGTGAAAATTCAAAATTT;ACCGGTTTTGAAGTGAAAATTCAAAATTT)
Alt rs386833472(ACCGGTTTTGAAGTGAAAATTCAAAATTT;ACCGGTTTTGAAGTGAAAATTCAAAATTT)
Reference rs386833472(GG;GG)
Significance Probable-Pathogenic
Disease Congenital secretory diarrhea
Variation info
Gene SLC26A3
CLNDBN Congenital secretory diarrhea, chloride type
Reversed 1
HGVS NC_000007.13:g.107408311_107408312delCCinsAAATTTTGAATTTTCACTTCAAAACCGGT
CLNSRC ClinVar
CLNACC RCV000049399.1,


[PMID 11524734] Identification of seven novel mutations including the first two genomic rearrangements in SLC26A3 mutated in congenital chloride diarrhea.