Have questions? Visit https://www.reddit.com/r/SNPedia

rs386833741

From SNPedia

ClinVar
Risk rs386833741(;)
Alt rs386833741(;)
Reference rs386833741(ATACCGCTGGTAAGAGGAGCGAGGGCA;ATACCGCTGGTAAGAGGAGCGAGGGCA)
Significance Probable-Pathogenic
Disease Juvenile neuronal ceroid lipofuscinosis
Variation info
Gene NPIPB8 CLN3
CLNDBN Juvenile neuronal ceroid lipofuscinosis
Reversed 1
HGVS NC_000016.9:g.28493630_28493656del27
CLNSRC ClinVar
CLNACC RCV000049705.1,


[PMID 21990111] Update of the mutation spectrum and clinical correlations of over 360 mutations in eight genes that underlie the neuronal ceroid lipofuscinoses.