Have questions? Visit https://www.reddit.com/r/SNPedia

rs386833891

From SNPedia

ClinVar
Risk rs386833891(;)
Alt rs386833891(;)
Reference rs386833891(TTCCACAGGCTGGAGGGCGTGGCCGCCCCACCCCGG;TTCCACAGGCTGGAGGGCGTGGCCGCCCCACCCCGG)
Significance Probable-Pathogenic
Disease Finnish congenital nephrotic syndrome
Variation info
Gene NPHS1
CLNDBN Finnish congenital nephrotic syndrome
Reversed 1
HGVS NC_000019.9:g.36336422_36336457del36
CLNSRC ClinVar
CLNACC RCV000049862.1,


[PMID 20172850OA-icon.png] Nineteen novel NPHS1 mutations in a worldwide cohort of patients with congenital nephrotic syndrome (CNS).