Have questions? Visit https://www.reddit.com/r/SNPedia

rs386834043

From SNPedia

ClinVar
Risk rs386834043(;)
Alt rs386834043(;)
Reference rs386834043(AGAAACCTGAGGCTGTCCCAATGGCATGC;AGAAACCTGAGGCTGTCCCAATGGCATGC)
Significance Pathogenic
Disease Meckel-Gruber syndrome
Variation info
Gene MKS1
CLNDBN Meckel-Gruber syndrome
Reversed 1
HGVS NC_000017.10:g.56283914_56283942del29
CLNSRC OMIM Allelic Variant
CLNACC RCV000168467.1,


[PMID 16415886] MKS1, encoding a component of the flagellar apparatus basal body proteome, is mutated in Meckel syndrome.


[PMID 17377820] Molecular diagnostics of Meckel-Gruber syndrome highlights phenotypic differences between MKS1 and MKS3.


[PMID 17397051] Spectrum of MKS1 and MKS3 mutations in Meckel syndrome: a genotype-phenotype correlation. Mutation in brief #960. Online.


[PMID 17437276] Aberrant splicing is a common mutational mechanism in MKS1, a key player in Meckel-Gruber syndrome.


[PMID 17935508] A disease causing deletion of 29 base pairs in intron 15 in the MKS1 gene is highly associated with the campomelic variant of the Meckel-Gruber syndrome.