Have questions? Visit https://www.reddit.com/r/SNPedia

rs386834175

From SNPedia

ClinVar
Risk rs386834175(;)
Alt rs386834175(;)
Reference rs386834175(CTCCAGCCCCTGGGCGGCCGCTGCCCCCAGGCCGCCTGCCACAGCGCC;CTCCAGCCCCTGGGCGGCCGCTGCCCCCAGGCCGCCTGCCACAGCGCC)
Significance Probable-Pathogenic
Disease Megaloblastic anemia due to inborn errors of metabolism
Variation info
Gene AMN
CLNDBN Megaloblastic anemia due to inborn errors of metabolism
Reversed 0
HGVS NC_000014.8:g.103395796_103395843del48
CLNSRC ClinVar
CLNACC RCV000050170.1,


[PMID 15024727] Genetically heterogeneous selective intestinal malabsorption of vitamin B12: founder effects, consanguinity, and high clinical awareness explain aggregations in Scandinavia and the Middle East.