Have questions? Visit https://www.reddit.com/r/SNPedia

rs387906296

From SNPedia

ClinVar
Risk rs387906296(;)
Alt rs387906296(;)
Reference rs387906296(CACCCTGATCCAGCGCACAATCCGTGA;CACCCTGATCCAGCGCACAATCCGTGA)
Significance Other
Disease Apocrine gland secretion
Variation info
Gene ABCC11
CLNDBN Apocrine gland secretion, variation in
Reversed 1
HGVS NC_000016.9:g.48201498_48201524del27
CLNSRC OMIM Allelic Variant
CLNACC RCV000003740.5,