Have questions? Visit https://www.reddit.com/r/SNPedia

rs387906321

From SNPedia

ClinVar
Risk rs387906321(AGCGGCTGCAGCAGCTGCGGCTGCAGCCGC;AGCGGCTGCAGCAGCTGCGGCTGCAGCCGC)
Alt rs387906321(AGCGGCTGCAGCAGCTGCGGCTGCAGCCGC;AGCGGCTGCAGCAGCTGCGGCTGCAGCCGC)
Reference rs387906321(;)
Significance Pathogenic
Disease Blepharophimosis syndrome type 2 Blepharophimosis
Variation info
Gene FOXL2 FOXL2NB C3orf72
CLNDBN Blepharophimosis syndrome type 2 Blepharophimosis, ptosis, and epicanthus inversus, type II with duane retraction syndrome
Reversed 1
HGVS NC_000003.11:g.138664864_138664893dup30
CLNSRC OMIM Allelic Variant
CLNACC RCV000005127.2, RCV000005128.2,