Have questions? Visit https://www.reddit.com/r/SNPedia

rs387906493

From SNPedia

ClinVar
Risk rs387906493(GGGCCGCCGCGGCAGCCGCGGCCG;GGGCCGCCGCGGCAGCCGCGGCCG)
Alt rs387906493(GGGCCGCCGCGGCAGCCGCGGCCG;GGGCCGCCGCGGCAGCCGCGGCCG)
Reference rs387906493(;)
Significance Pathogenic
Disease Epileptic encephalopathy Mental retardation Partington X-linked mental retardation syndrome
Variation info
Gene ARX
CLNDBN Epileptic encephalopathy, early infantile, 1 Mental retardation, with or without seizures, ARX-related, X-linked Partington X-linked mental retardation syndrome
Reversed 1
HGVS NC_000023.10:g.25031661_25031684dup24
CLNSRC OMIM Allelic Variant
CLNACC RCV000011937.9, RCV000011938.9, RCV000033212.17,