Have questions? Visit https://www.reddit.com/r/SNPedia

rs387907180

From SNPedia

ClinVar
Risk rs387907180(;)
Alt rs387907180(;)
Reference rs387907180(TCTGTAGTGAAGAATCAAAA;TCTGTAGTGAAGAATCAAAA)
Significance Pathogenic
Disease Congenital disorder of glycosylation type 1P
Variation info
Gene ALG11 UTP14C
CLNDBN Congenital disorder of glycosylation type 1P
Reversed 0
HGVS NC_000013.10:g.52598489_52598508del20
CLNSRC OMIM Allelic Variant
CLNACC RCV000024339.4,