Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Geno Mag Summary
(-;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCA) 6 BRCA1 variant considered pathogenic for breast cancer

Make rs397507180(-;-)
ReferenceGRCh38 38.1/141
is asnp
is mentioned by
1000 genomesrs397507180
23andMe allrs397507180
SNP Nexus

GWAS Ctlgrs397507180
Max Magnitude6
Significance Pathogenic
Disease Breast-ovarian cancer
Variation info
Gene BRCA1
CLNDBN Breast-ovarian cancer, familial 1
Reversed 1
HGVS NC_000017.10:g.41246333_41246373del41
CLNACC RCV000030975.3,