Have questions? Visit https://www.reddit.com/r/SNPedia

rs397507181

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAA) 6 BRCA1 variant considered pathogenic for breast cancer
(TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAA;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAA) 0 common in clinvar


Make rs397507181(-;-)
ReferenceGRCh38 38.1/141
Chromosome17
Position43094315
GeneBRCA1
is asnp
is mentioned by
dbSNPrs397507181
ebirs397507181
HLIrs397507181
Exacrs397507181
Varsomers397507181
Maprs397507181
PheGenIrs397507181
hapmaprs397507181
1000 genomesrs397507181
hgdprs397507181
ensemblrs397507181
gopubmedrs397507181
geneviewrs397507181
scholarrs397507181
googlers397507181
pharmgkbrs397507181
gwascentralrs397507181
openSNPrs397507181
23andMers397507181
23andMe allrs397507181
SNP Nexus

SNPshotrs397507181
SNPdbers397507181
MSV3drs397507181
GWAS Ctlgrs397507181
Max Magnitude6
ClinVar
Risk
Alt
Reference Rs397507181(TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAA;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAA)
Significance Pathogenic
Disease Breast-ovarian cancer
Variation info
Gene BRCA1
CLNDBN Breast-ovarian cancer, familial 1
Reversed 1
HGVS NC_000017.10:g.41246332_41246373del42
CLNSRC ClinVar
CLNACC RCV000030976.3,