Have questions? Visit https://www.reddit.com/r/SNPedia

rs397507183

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAAT) 6 BRCA1 variant considered pathogenic for breast cancer
(TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAAT;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAAT) 0 common in clinvar


Make rs397507183(-;-)
ReferenceGRCh38 38.1/141
Chromosome17
Position43094313
GeneBRCA1
is asnp
is mentioned by
dbSNPrs397507183
ebirs397507183
HLIrs397507183
Exacrs397507183
Varsomers397507183
Maprs397507183
PheGenIrs397507183
hapmaprs397507183
1000 genomesrs397507183
hgdprs397507183
ensemblrs397507183
gopubmedrs397507183
geneviewrs397507183
scholarrs397507183
googlers397507183
pharmgkbrs397507183
gwascentralrs397507183
openSNPrs397507183
23andMers397507183
23andMe allrs397507183
SNP Nexus

SNPshotrs397507183
SNPdbers397507183
MSV3drs397507183
GWAS Ctlgrs397507183
Max Magnitude6
ClinVar
Risk
Alt
Reference Rs397507183(TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAAT;TGTTAGGTTCTGATGACTCACATGATGGGGAGTCTGAATCAAAT)
Significance Pathogenic
Disease Breast-ovarian cancer
Variation info
Gene BRCA1
CLNDBN Breast-ovarian cancer, familial 1
Reversed 1
HGVS NC_000017.10:g.41246330_41246373del44
CLNSRC ClinVar
CLNACC RCV000030978.3,