Have questions? Visit https://www.reddit.com/r/SNPedia

rs397508103

From SNPedia

ClinVar
Risk rs397508103(;)
Alt rs397508103(;)
Reference rs397508103(CCCAGAGAGGGCGGGGCCCA;CCCAGAGAGGGCGGGGCCCA)
Significance Pathogenic
Disease Jervell and Lange-Nielsen syndrome 1 Long QT syndrome Cardiac arrhythmia
Variation info
Gene KCNQ1-AS1 KCNQ1
CLNDBN Jervell and Lange-Nielsen syndrome 1 Long QT syndrome, LQT1 subtype Cardiac arrhythmia
Reversed 0
HGVS NC_000011.9:g.2869094_2869113del20
CLNSRC OMIM Allelic Variant
CLNACC RCV000003285.2, RCV000046038.2, RCV000182287.1,