Have questions? Visit https://www.reddit.com/r/SNPedia

rs397508136(-;CGAGAGACCATGCAGAGGTCGCC)

From SNPedia

carrier of a cystic fibrosis allele
Is agenotype
ofrs397508136
GeneCFTR
Chromosome7
Position117,480,086
mentionedby
Magnitude3
ReputeBad
Geno Mag Summary
(-;CGAGAGACCATGCAGAGGTCGCC) 3 carrier of a cystic fibrosis allele
(CGAGAGACCATGCAGAGGTCGCC;CGAGAGACCATGCAGAGGTCGCC) 0 common in clinvar

Cystic fibrosis mutation carrier; unaffected unless CF mutation present on other copy of CF gene