Have questions? Visit https://www.reddit.com/r/SNPedia

rs397508474

From SNPedia

ClinVar
Risk rs397508474(;)
Alt rs397508474(;)
Reference rs397508474(ATTGTGATTGGAGCTATAGCAG;ATTGTGATTGGAGCTATAGCAG)
Significance Untested
Disease Cystic fibrosis
Variation info
Gene CFTR
CLNDBN Cystic fibrosis
Reversed 0
HGVS NC_000007.13:g.117250582_117250603del22
CLNSRC ClinVar
CLNACC RCV000046748.2,