Have questions? Visit https://www.reddit.com/r/SNPedia

rs397508955

From SNPedia

ClinVar
Risk rs397508955(AGAGAGTAGCAGTATTTCAT;AGAGAGTAGCAGTATTTCAT) rs397508955(CT;CT)
Alt rs397508955(AGAGAGTAGCAGTATTTCAT;AGAGAGTAGCAGTATTTCAT) rs397508955(CT;CT)
Reference Rs397508955(T;T)
Significance Pathogenic
Disease Familial cancer of breast Breast-ovarian cancer
Variation info
Gene BRCA1
CLNDBN Familial cancer of breast Breast-ovarian cancer, familial 1
Reversed 1
HGVS NC_000017.10:g.41245237_41245238insG; NC_000017.10:g.41245238_41245256dup19
CLNSRC ClinVar
CLNACC RCV000047795.2, RCV000047784.2, RCV000257197.2,