Have questions? Visit https://www.reddit.com/r/SNPedia

rs397508955

From SNPedia

ClinVar
Risk rs397508955(AGAGAGTAGCAGTATTTCAT,CT;AGAGAGTAGCAGTATTTCAT,CT)
Alt rs397508955(AGAGAGTAGCAGTATTTCAT,CT;AGAGAGTAGCAGTATTTCAT,CT)
Reference rs397508955(T;T)
Significance Untested
Disease Familial cancer of breast
Variation info
Gene BRCA1
CLNDBN Familial cancer of breast
Reversed 1
HGVS NC_000017.10:g.41245237_41245238insG; NC_000017.10:g.41245238_41245256dup19
CLNSRC ClinVar
CLNACC RCV000047795.2, RCV000047784.2,