Have questions? Visit https://www.reddit.com/r/SNPedia

rs397509186

From SNPedia

ClinVar
Risk rs397509186(;)
Alt rs397509186(;)
Reference rs397509186(AAACATCTTACTTGCCAAGG;AAACATCTTACTTGCCAAGG)
Significance Untested
Disease Familial cancer of breast
Variation info
Gene BRCA1
CLNDBN Familial cancer of breast
Reversed 1
HGVS NC_000017.10:g.41226358_41226377del20
CLNSRC ClinVar
CLNACC RCV000048617.2,