Have questions? Visit https://www.reddit.com/r/SNPedia

rs397509302

From SNPedia

ClinVar
Risk rs397509302(AGGGATGAAATCAGGAGCCA;AGGGATGAAATCAGGAGCCA)
Alt rs397509302(AGGGATGAAATCAGGAGCCA;AGGGATGAAATCAGGAGCCA)
Reference rs397509302(;)
Significance Untested
Disease Familial cancer of breast
Variation info
Gene BRCA1
CLNDBN Familial cancer of breast
Reversed 1
HGVS NC_000017.10:g.41247908_41247909insTGGCTCCTGATTTCATCCCT
CLNSRC ClinVar
CLNACC RCV000049074.2,