Have questions? Visit https://www.reddit.com/r/SNPedia

rs397509374

From SNPedia

ClinVar
Risk
Alt
Reference Rs397509374(CTCCGGGTGAGAAAGGTGAAGGAGGCC;CTCCGGGTGAGAAAGGTGAAGGAGGCC)
Significance Pathogenic
Disease Ehlers-Danlos syndrome
Variation info
Gene COL3A1
CLNDBN Ehlers-Danlos syndrome, type 4
Reversed 0
HGVS NC_000002.11:g.189867725_189867751del27
CLNSRC OMIM Allelic Variant
CLNACC RCV000018754.27,