Have questions? Visit https://www.reddit.com/r/SNPedia

rs397514254

From SNPedia

ClinVar
Risk rs397514254(CGGCGAGGTGCAGGCCATGCT;CGGCGAGGTGCAGGCCATGCT)
Alt rs397514254(CGGCGAGGTGCAGGCCATGCT;CGGCGAGGTGCAGGCCATGCT)
Reference rs397514254(;)
Significance Pathogenic
Disease Familial type 3 hyperlipoproteinemia
Variation info
Gene APOE
CLNDBN Familial type 3 hyperlipoproteinemia
Reversed 0
HGVS NC_000019.9:g.45411968_45411988dup21
CLNSRC OMIM Allelic Variant
CLNACC RCV000019434.27,