Have questions? Visit https://www.reddit.com/r/SNPedia

rs397514545

From SNPedia

ClinVar
Risk rs397514545(;)
Alt rs397514545(;)
Reference rs397514545(ACGTGATGACAGCTGGCAACTGTGGGAA;ACGTGATGACAGCTGGCAACTGTGGGAA)
Significance Pathogenic
Disease Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies)
Variation info
Gene TMEM5
CLNDBN Muscular dystrophy-dystroglycanopathy (congenital with brain and eye anomalies), type a, 10
Reversed 0
HGVS NC_000012.11:g.64202604_64202631del28
CLNSRC OMIM Allelic Variant
CLNACC RCV000032806.2,