Have questions? Visit https://www.reddit.com/r/SNPedia

rs397514818

From SNPedia

ClinVar
Risk rs397514818(;)
Alt rs397514818(;)
Reference rs397514818(CAGTGCTGATGAAAGCCCTGCGG;CAGTGCTGATGAAAGCCCTGCGG)
Significance Pathogenic
Disease Tuberous sclerosis 1 Tuberous sclerosis syndrome
Variation info
Gene TSC1
CLNDBN Tuberous sclerosis 1 Tuberous sclerosis syndrome
Reversed 1
HGVS NC_000009.11:g.135781263_135781285del23
CLNSRC OMIM Allelic Variant Tuberous sclerosis database (TSC1)
CLNACC RCV000005407.2, RCV000054946.1,