Have questions? Visit https://www.reddit.com/r/SNPedia

rs397515345

From SNPedia

ClinVar
Risk rs397515345(;)
Alt rs397515345(;)
Reference rs397515345(TCGGACGAGGACAGCGTCTC;TCGGACGAGGACAGCGTCTC)
Significance Pathogenic
Disease Usher syndrome Usher syndrome
Variation info
Gene USH1G
CLNDBN Usher syndrome, type 1G Usher syndrome, type 1
Reversed 1
HGVS NC_000017.10:g.72916080_72916099del20
CLNSRC OMIM Allelic Variant
CLNACC RCV000003050.4, RCV000216021.1,