Have questions? Visit https://www.reddit.com/r/SNPedia

rs397515375

From SNPedia

ClinVar
Risk rs397515375(;)
Alt rs397515375(;)
Reference rs397515375(GCCTGCTGCTCACCGCCGCGC;GCCTGCTGCTCACCGCCGCGC)
Significance Pathogenic
Disease Holoprosencephaly 3
Variation info
Gene SHH
CLNDBN Holoprosencephaly 3
Reversed 1
HGVS NC_000007.13:g.155596175_155596195del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000009434.3,