Have questions? Visit https://www.reddit.com/r/SNPedia

rs397515495

From SNPedia

ClinVar
Risk rs397515495(AACCTGGACCAATGGGACCAATGGGAACAC;AACCTGGACCAATGGGACCAATGGGAACAC)
Alt rs397515495(AACCTGGACCAATGGGACCAATGGGAACAC;AACCTGGACCAATGGGACCAATGGGAACAC)
Reference rs397515495(CCTCCTGG;CCTCCTGG)
Significance Pathogenic
Disease Alport syndrome
Variation info
Gene COL4A5
CLNDBN Alport syndrome, X-linked recessive
Reversed 0
HGVS NC_000023.10:g.107858179_107858186delCCTCCTGGinsAACCTGGACCAATGGGACCAATGGGAACAC
CLNSRC ClinVar
CLNACC RCV000032065.1,