Have questions? Visit https://www.reddit.com/r/SNPedia

rs397516058

From SNPedia

ClinVar
Risk rs397516058(;)
Alt rs397516058(;)
Reference rs397516058(GCCAGCCTCCTGAAGCCGCC;GCCAGCCTCCTGAAGCCGCC)
Significance Pathogenic
Disease Primary familial hypertrophic cardiomyopathy
Variation info
Gene MYBPC3
CLNDBN Primary familial hypertrophic cardiomyopathy
Reversed 1
HGVS NC_000011.9:g.47371420_47371439del20
CLNSRC ClinVar
CLNACC RCV000035645.2,