Have questions? Visit https://www.reddit.com/r/SNPedia

rs397516667

From SNPedia

ClinVar
Risk rs397516667(;)
Alt rs397516667(;)
Reference rs397516667(CCAGGACCCCCAGGACCTCCAGGACCCC;CCAGGACCCCCAGGACCTCCAGGACCCC)
Significance Pathogenic
Disease Hypohidrotic ectodermal dysplasia
Variation info
Gene EDA
CLNDBN Hypohidrotic ectodermal dysplasia
Reversed 0
HGVS NC_000023.10:g.69247742_69247769del28
CLNSRC ClinVar
CLNACC RCV000037177.2,