Have questions? Visit https://www.reddit.com/r/SNPedia

rs397517030

From SNPedia

ClinVar
Risk rs397517030(AC;AC)
Alt rs397517030(AC;AC)
Reference rs397517030(GCACTTGACTGTCGGCCAGGCGGCCGCAGGGGG;GCACTTGACTGTCGGCCAGGCGGCCGCAGGGGG)
Significance Probable-Pathogenic
Disease Arrhythmogenic right ventricular cardiomyopathy
Variation info
Gene PKP2
CLNDBN Arrhythmogenic right ventricular cardiomyopathy
Reversed 1
HGVS NC_000012.11:g.33030831_33030863del33insGT
CLNSRC ClinVar
CLNACC RCV000038232.2,