Have questions? Visit https://www.reddit.com/r/SNPedia

rs397518417

From SNPedia

ClinVar
Risk rs397518417(;)
Alt rs397518417(;)
Reference rs397518417(TAGGCGGGATGGTGCCGCTGTGC;TAGGCGGGATGGTGCCGCTGTGC)
Significance Pathogenic
Disease Molybdenum cofactor deficiency
Variation info
Gene MOCS2 LOC257396
CLNDBN Molybdenum cofactor deficiency, complementation group B
Reversed 1
HGVS NC_000005.9:g.52405545_52405567del23
CLNSRC OMIM Allelic Variant
CLNACC RCV000006490.3,