Have questions? Visit https://www.reddit.com/r/SNPedia

rs397704705

From SNPedia

ClinVar
Risk rs397704705(TGCTGTAAACTGTAACTGTAAA;TGCTGTAAACTGTAACTGTAAA)
Alt rs397704705(TGCTGTAAACTGTAACTGTAAA;TGCTGTAAACTGTAACTGTAAA)
Reference rs397704705(GGAT;GGAT)
Significance Pathogenic
Disease Spastic paraplegia 48
Variation info
Gene AP5Z1
CLNDBN Spastic paraplegia 48, autosomal recessive
Reversed 0
HGVS NC_000007.13:g.4820844_4820847delGGATinsTGCTGTAAACTGTAACTGTAAA
CLNSRC OMIM Allelic Variant
CLNACC RCV000000012.3,