Have questions? Visit https://www.reddit.com/r/SNPedia

rs398122832

From SNPedia

ClinVar
Risk rs398122832(;)
Alt rs398122832(;)
Reference rs398122832(AGATCAATGGCTACCCCAAA;AGATCAATGGCTACCCCAAA)
Significance Pathogenic
Disease Marfan lipodystrophy syndrome
Variation info
Gene FBN1
CLNDBN Marfan lipodystrophy syndrome
Reversed 1
HGVS NC_000015.9:g.48704817_48704836del20
CLNSRC OMIM Allelic Variant
CLNACC RCV000033242.29,