Have questions? Visit https://www.reddit.com/r/SNPedia

rs398123112

From SNPedia

ClinVar
Risk
Alt
Reference Rs398123112(TCTGGTGGCCCACGCCTACCGCC;TCTGGTGGCCCACGCCTACCGCC)
Significance Pathogenic
Disease Adrenoleukodystrophy
Variation info
Gene BCAP31 ABCD1
CLNDBN Adrenoleukodystrophy
Reversed 0
HGVS NC_000023.10:g.152991219_152991241del23
CLNSRC ClinVar
CLNACC RCV000077966.4,