Have questions? Visit https://www.reddit.com/r/SNPedia

rs398123693

From SNPedia

ClinVar
Risk rs398123693(;)
Alt rs398123693(;)
Reference rs398123693(GCGGCGGCGGCAACTCCACC;GCGGCGGCGGCAACTCCACC)
Significance Pathogenic
Disease not provided
Variation info
Gene SOX2-OT SOX2
CLNDBN not provided
Reversed 0
HGVS NC_000003.11:g.181430218_181430237del20
CLNSRC HGMD
CLNACC RCV000080064.4,