Have questions? Visit https://www.reddit.com/r/SNPedia

rs398124628

From SNPedia

ClinVar
Risk rs398124628(GCACAGCCACCGCTGCAGCT;GCACAGCCACCGCTGCAGCT)
Alt rs398124628(GCACAGCCACCGCTGCAGCT;GCACAGCCACCGCTGCAGCT)
Reference rs398124628(;)
Significance Pathogenic
Disease Acute megakaryoblastic leukemia
Variation info
Gene GATA1
CLNDBN Acute megakaryoblastic leukemia
Reversed 0
HGVS NC_000023.10:g.48649670_48649689dup20
CLNSRC OMIM Allelic Variant
CLNACC RCV000011174.3,