Have questions? Visit https://www.reddit.com/r/SNPedia

rs4795541

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) normal
(-;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG) complex; see details
(AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG;AGATGCTGGGGGGGCTGCAGGGGGGATGCTGGGGGTGCAGGGG) complex; see details
ReferenceGRCh38 38.1/141
Chromosome17
Position30237341
GeneSLC6A4
is asnp
is mentioned by
dbSNPrs4795541
ebirs4795541
HLIrs4795541
Exacrs4795541
Varsomers4795541
Maprs4795541
PheGenIrs4795541
hapmaprs4795541
1000 genomesrs4795541
hgdprs4795541
ensemblrs4795541
gopubmedrs4795541
geneviewrs4795541
scholarrs4795541
googlers4795541
pharmgkbrs4795541
gwascentralrs4795541
openSNPrs4795541
23andMers4795541
23andMe allrs4795541
SNP Nexus

SNPshotrs4795541
SNPdbers4795541
MSV3drs4795541
GWAS Ctlgrs4795541
Max Magnitude
This SNP represents a polymorphic region consisting of an "in/del", i.e. either an insertion or a deletion, of 43 or 44 nucleotides. This SNP is commonly known as the 5-HTTLPR variant of the serotonin transporter SLC6A4 gene. The deletion allele is referred to as the "S" allele, the insertion allele is known as the "L" allele, and hence the genotypes are usually called the LL, SL, and SS genotypes in publications. Note, however, that this is actually a tri-allelic SNP, in that on occasion, a single nucleotide, usually a G, may be present at this position.

This SNP has been studied in many contexts, including the following:

It is beyond the current scope to summarize all the associations seen for this SNP, as well as the lack of replication reported in some follow-on studies.

[PMID 19487392] Serotonin Transporter Gene (SLC6A4) Promoter Polymorphisms and the Susceptibility to Posttraumatic Stress Disorder in the General Population


[PMID 20502016] Polymorphism C in the Serotonin Transporter Gene in Depression-Free Elderly Patients with Vascular Dementia




[PMID 17629953] Loudness dependence of auditory evoked potentials is not associated with polymorphisms or haplotypes in the serotonin transporter gene in a community-based sample of German healthy volunteers.


[PMID 18081710OA-icon.png] Multivariate permutation analysis associates multiple polymorphisms with subphenotypes of major depression.


[PMID 19721846OA-icon.png] Candidate genes involved in neural plasticity and the risk for attention-deficit hyperactivity disorder: a meta-analysis of 8 common variants.


[PMID 19940176OA-icon.png] Functional variation of the dopamine D2 receptor gene is associated with emotional control as well as brain activity and connectivity during emotion processing in humans.

[PMID 23728717] Common functional polymorphisms in SLC6A4 and COMT genes are associated with circadian phenotypes in a South American sample