Have questions? Visit https://www.reddit.com/r/SNPedia

rs515726210

From SNPedia

ClinVar
Risk
Alt
Reference Rs515726210(ACACCCGCAAGAAGCCGGTAGTCT;ACACCCGCAAGAAGCCGGTAGTCT)
Significance Pathogenic
Disease Hereditary pancreatitis
Variation info
Gene CTRC
CLNDBN Hereditary pancreatitis
Reversed 0
HGVS NC_000001.10:g.15772190_15772213del24
CLNSRC ClinVar
CLNACC RCV000119046.2,