Have questions? Visit https://www.reddit.com/r/SNPedia

rs587776535

From SNPedia

ClinVar
Risk rs587776535(;)
Alt rs587776535(;)
Reference rs587776535(GGCGCGGGGATCTAGGACGCCG;GGCGCGGGGATCTAGGACGCCG)
Significance Pathogenic
Disease Premature ovarian failure 6
Variation info
Gene FIGLA
CLNDBN Premature ovarian failure 6
Reversed 0
HGVS NC_000002.12:g.70790603_70790624del22
CLNSRC OMIM Allelic Variant
CLNACC RCV000002219.2,