Have questions? Visit https://www.reddit.com/r/SNPedia

rs587776824

From SNPedia

ClinVar
Risk
Alt
Reference Rs587776824(GGGCGGGCGGCGGCGGCGGCA;GGGCGGGCGGCGGCGGCGGCA)
Significance Pathogenic
Disease VACTERL association
Variation info
Gene HOXD13
CLNDBN VACTERL association
Reversed 0
HGVS NC_000002.11:g.176957782_176957802del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000016005.28,