Have questions? Visit https://www.reddit.com/r/SNPedia

rs587777056

From SNPedia

ClinVar
Risk rs587777056(;)
Alt rs587777056(;)
Reference rs587777056(CCACTTCACATTCAAGAACCT;CCACTTCACATTCAAGAACCT)
Significance Pathogenic
Disease Early infantile epileptic encephalopathy 17
Variation info
Gene GNAO1
CLNDBN Early infantile epileptic encephalopathy 17
Reversed 0
HGVS NC_000016.9:g.56368748_56368768del21
CLNSRC OMIM Allelic Variant
CLNACC RCV000056407.26,