Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Significance Probable-Pathogenic
Disease not specified Kabuki make-up syndrome
Variation info
Gene KMT2D
CLNDBN not specified Kabuki make-up syndrome
Reversed 1
HGVS NC_000012.11:g.49445190_49445216delGGCTCCTCAGGCCGGGGGGACAGGTGC
CLNACC RCV000121368.1, RCV000146194.1,