common in clinvar |
Is a | genotype |
of | rs587778959 |
Gene | MLH1 |
Chromosome | 3 |
Position | 37,048,562 |
mentioned | by |
Magnitude | 0 |
Repute | Good |
Geno | Mag | Summary |
---|---|---|
(-;-) | 0 | common in clinvar |
(-;ATTACCCCTTCTGATTGACAACTATGTGC) | 6 | Lynch syndrome, pathogenic mutation |
Have questions? Visit https://www.reddit.com/r/SNPedia
common in clinvar |
Is a | genotype |
of | rs587778959 |
Gene | MLH1 |
Chromosome | 3 |
Position | 37,048,562 |
mentioned | by |
Magnitude | 0 |
Repute | Good |
Geno | Mag | Summary |
---|---|---|
(-;-) | 0 | common in clinvar |
(-;ATTACCCCTTCTGATTGACAACTATGTGC) | 6 | Lynch syndrome, pathogenic mutation |