Have questions? Visit https://www.reddit.com/r/SNPedia

rs587779560

From SNPedia

ClinVar
Risk rs587779560(;)
Alt rs587779560(;)
Reference rs587779560(GGTGCTGCTGGTCCTCCTGGGCCACCT;GGTGCTGCTGGTCCTCCTGGGCCACCT)
Significance Pathogenic
Disease Ehlers-Danlos syndrome
Variation info
Gene COL3A1
CLNDBN Ehlers-Danlos syndrome, type 4
Reversed 0
HGVS NC_000002.11:g.189864196_189864222del27
CLNSRC
CLNACC RCV000087503.1,