Have questions? Visit https://www.reddit.com/r/SNPedia

rs587779657

From SNPedia

ClinVar
Risk
Alt
Reference Rs587779657(CTCCTGGGCCACCTGGTGCTGCTGGTA;CTCCTGGGCCACCTGGTGCTGCTGGTA)
Significance Pathogenic
Disease Ehlers-Danlos syndrome
Variation info
Gene COL3A1
CLNDBN Ehlers-Danlos syndrome, type 4
Reversed 0
HGVS NC_000002.11:g.189864216_189864242del27
CLNSRC
CLNACC RCV000087638.1,