Have questions? Visit https://www.reddit.com/r/SNPedia

rs587779859

From SNPedia

ClinVar
Risk
Alt
Reference Rs587779859(TTCTTATACAGAACAATCCCAGCC;TTCTTATACAGAACAATCCCAGCC)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene C11orf65 ATM
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 0
HGVS NC_000011.9:g.108198362_108198385del24
CLNSRC
CLNACC RCV000115237.2,